molecular biology - Synthetic construct with multiple ORFs not expressing

I designed a synthetic construct on paper and got it synthesized from a company. The objective was to make a vector which can be used to study both transcriptional and post-transcriptional regulation by different cis-elements (2-3 different cis-elements can be studied simultaneously).

The construct is like this:

SmaI-RES1-CMV-RES1’-GFP-MCS1-SV40PA-Linker-RES2-CMV-RES2’-RFP-MCS2-SV40PA-Linker-RES3-CMV-RES3’- YFP-MCS3-SV40PA-ΔLinker-SmaI

where:

RES1 = KpnI [GGTACC] 
RES1’= SalI [GTCGAC] 
MCS1 = EcoRI+BamHI [GAATTCTGGATCC] 
RES2 = ClaI [ATCGAT] 
RES2’= NheI [GCTAGC] 
MCS2 = SpeI+HindIII [ACTAGTAAGCTT] 
RES3 = XbaI [TCTAGA] 
RES3’= PvuI [CGATCG] 
MCS3 = NotI+SacI[GCGGCCGCGAGCTC]
Kozak consensus sequence = GCCACCATGG
Linker (100bp) = AATTCTGGATCCTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCGAATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGC

GFP, RFP and YFP are fast turnover variants with MODC pest sequence. I took the sequences for these proteins from Evrogen website. I took the Sv40 polyA signal sequence from one of their vectors in order to avoid any event of incompatibility. Kozak sequence was also taken from those vectors only. The total size it ~4.8kb. For CMV promoter I took the standard sequence used in most vectors.

With this vector I could clone any post-transcriptional regulatory sequence between stop codon and SV40PA, and could change promoters as well.

With the CMV promoter and no 3'UTRs I see a very faint expression of GFP, but could not see any RFP expression. I used pMaxGFP and dsRed as a control for filter sensitivity.

I transfected the plasmid in Hela and Neuro2a and at various concentrations (1-5μg) using lipofectamine. The controls express well (transfected 1μg each) but I see very faint GFP expression and dont see any RFP expression.

I checked the sequencing QC report given by the company and there were no indels or other mismatches. I am clueless about why the construct fails to express.

Is the linker a problem; is 100bp not sufficient ?

human biology - Why do rod cells not recover after bleaching upon exposure to bright light?

In rods, the pigment Rhodopsin can be thought of as a receptor protein with a pre-bound chemical agonist. The receptor protein is called Opsin, and the pre-bound agonist is called retinal. The absorption of light causes a change in the conformation of retinal so that it activates the opsin, causing bleaching (changing the wavelengths absorbed by rhodopsin). The bleaching of rhodopsin stimulates a G-protein called transducin in the membrane, which activates phosphodiesterase, which in turn breaks down cGMP that is normally present in the cytoplasm of the rod and is necessary for the continued operation of the sodium channel sending the neural signal.

In the dark, the channel is open and the Rods are active. In bright light, due to the amplification from cascade effects, all of the channels will be closed, stopping the Rods from sending their normal signals until cGMP levels are able to compensate.

My guess is that the bleaching ceases fairly quickly and the proteins return to their original conforms shortly, but it's the cGMP levels (remember, cGMP is destroyed, so any new cGMP replacing the old must be synthesized first) that take a long time to recover as the signal to destroy the cGMP initiates a cascade that results in strong amplifications.

biochemistry - Breaking of fats

I think that the main reason (but probably not the only one) is because fats are hydrophobic, while the environment of the digestive tract is aqueous. Most of the fats in the diet are triglyceride and in hydrophilic environment they form globules. Triglycerides must be hydrolysed to be absorbed by the duodenum and this work is done by pancreatic lipase, that is a water soluble enzyme and can only hydrolyse the esteric bonds at the surface of fat globules.

Therefore, during the digestion amphipathic molecules such as bile salts and phospholipids emulsify those droplets in smaller ones, increasing the surface area where lipases, together with colipase can digest.

neuroscience - What happens in your brain when you receive information which causes you to bristle?

One thing is that we can't control the Goosebumps. It is an involuntary function caused by the Sympathetic Nervous System which is the major part of the Automatic Nervous System. The major function of the SNS is fight to flight response along with maintaining homeostasis in which case it internally will be alert maintaining body status from the background.

Before sending any response to target tissue when there is input to SNS it has to secrete neurotransmitters but before this to the sympatho-adrenal response of the body, as the preganglionic sympathetic fibers that end in the adrenal medulla (but also all other sympathetic fibers) secrete acetylcholine, which activates the great secretion of adrenaline (epinephrine) and to a lesser extent noradrenaline (norepinephrine) from it.

So whenever SNS senses (message flow is bidirectional) any stress it responds it in following action mentioned:

At the synapses within the ganglia, preganglionic neurons release acetylcholine, a neurotransmitter that activates nicotinic acetylcholine receptors on postganglionic neurons. In response to this stimulus postganglionic neurons - with two important exceptions - release norepinephrine, which activates adrenergic receptors on the peripheral target tissues. The activation of target tissue receptors causes the effects associated with the sympathetic system.

Once the receptors receive the information then the response flows to the target tissue via neurons with the help of the neurotransmitters. To explain goosebumps technically:

Properly known as piloerection, horripliation or pilomotor reflex, the bumps we get are stimulated by fear and cold and they are essentially just a temporary change in the skin. These stimulants cause a nerve discharge from the sympathetic nervous system (which is an involuntary portion of nerves we have) and the nerve discharges create muscle contractions called arrrectores pilorum that raise the hair follicles in our skin. It is the elevation of the hair that causes the Goosebumps. The name Goosebumps actually comes from the fact that plucked goose feathers resemble the human hair follicles.

Goosebumps also occur when we listen to surprise songs, sad songs or some other kind of thrilling music. Researchers have tried to explain it and they call it "Frisson".
Check out this small video which talks about it. It is nice:

http://www.youtube.com/watch?v=-EA2eWZuYDs

Also refer to this website: Goosebumps

biochemistry - What exactly happens if during translation, an amino acid is not present?

Point to know : aminoacyl-tRNA binds to mRNA its not just t-RNA..

So if there is no Amino-acid there is no aminoacyl-tRNA of that aminoacid.. so if there is no aminoacyl-tRNA, the anticodon of tRNA doesn't form a bond with mRNA, so the protein production halts (until the Amino acid produced).

If the protein is not formed within a certain long time, the premature protein folds itself and breaks. Then a molecule (example: ubiquitin for certain type of bacteria) attaches to this premature protein and marks it for degradation.

But there are still chances of protein production with slight mutations.

Mutation: tRNA with the same anticodon and different aminoacid can easily bind to the A site of the ribosome in the absence of the correct aminoacyl-tRNA, so the protein production doesn't stop in this case but the protein has a mutation with different aminoacid.